M 3 day old 100 female and 100 male Cx. quinquefasciatus were dissected and

M 3 day old 100 female and 100 male Cx. quinquefasciatus were dissected and collected in DEPC-water on ice using a stereo microscope (Zeiss, Stemi DR 1663, Germany). Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA). cDNA was synthesized from 0.5 .. g of total RNA using RT-for-PCR kit according to the manufacturer’s instructions (Clontech, Mountain View, CA). Real-time quantitative PCR (qPCR) was carried out by using a CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad, Hercules, CA) and SsoAdvanced SYBR Green Supermix (Bio-Rad, Hercules, CA): final volume 20 .. l, including 200 nM gene specific primers and approximately 50 ngJ Insect Physiol. Author manuscript; available in PMC 2014 September 01.Xu et al.Pageof cDNA. CquiRpS7 gene was used as reference. The primers were designed by Primer 3 program (http://frodo.wi.mit.edu/) and IDT online server (http://www.idtdna/scitools/ Applications/RealTimePCR/). CquiOR1 forward and reverse; 5 2 TCCGGAAAGGAAGATCATTG -3 2 5 -CGTTACAAACTCGGGACGAT -3 ; and 2 2 CquiOR44 forward and reverse; 5 -AGTGGCACAGTGAGATGCAG -3 2 5 2 and 2 CACCTCGAGCAGAAACATCA -3 ; CquiOR73 forward and reverse; 5 2 2 CTGGGTATGCTGAGGAACTTC-3 2 5 -GCAGCCAGATCCAAAAGTTG -3 ; and 2 2 CquiOR161 forward and reverse; 5 -GTCCAGAGCTGGATCCTCAG -3 2 5 2 and 2 AGCGAAAAGGCAAAGTTGAA -3 ; CquiRpS7 forward and reverse; 5 2 2 ATCCTGGAGCTGGAGATGA -3 and 5 -GATGACGATGGCCTTCTTGT -3 . Reactions 2 2 2 were run with the following standard program: 95 for 30 s, 39 cycles of 95 for 5 s, 55 for 10 s, 72 for 30 s, melt curve of 65 to 95 , increment 0.E1210 5 , 5 s. Data were analyzed using the 2- CT method using Bio-Rad CFX Manager 2.1 software. 2.5. In vitro transcription, oocyte microinjection and electrophysiology In vitro transcription of cRNAs was performed by using a mMESSAGE mMACHINE T7 Kit (Ambion) according to the manufacturer’s protocol. Briefly, plasmids were linearized with NheI or SphI, and capped cRNAs were transcribed using T7 RNA polymerase. The cRNAs were purified with LiCl precipitation solution and re-suspended in nuclease-free water at a concentration of 200 .. g/ml and stored at 80 in aliquots. RNA concentrations were determined by UV spectrophotometry. cRNA were microinjected (2 ng of CquiORX cRNA and 2 ng of CquiOrco cRNA) into stage V or VI Xenopus laevis oocytes (EcoCyte Bioscience, Austin TX). The oocytes were then incubated at 18 for 3 days in modified Barth’s solution [in mM: 88 NaCl, 1 KCl, 2.4 NaHCO3, 0.Ganciclovir 82 MgSO4, 0.PMID:29844565 33 Ca(NO3)2, 0.41 CaCl2, 10 HEPES, pH 7.4] supplemented with 10 .. g/ml of gentamycin, 10 .. g/ml of streptomycin and 1.8 mM sodium pyruvate. The two-electrode voltage clamp (TEVC) was employed to detect inward currents. Oocytes were placed in perfusion chamber and challenged with a panel of 90 compounds in a random order (flow rate was 10 ml/min). Chemical-induced currents were amplified with an OC-725C amplifier (Warner Instruments, Hamden, CT), voltage held at -70 mV, low-pass filtered at 50 Hz and digitized at 1 kHz. Data acquisition and analysis were carried out with Digidata 1440A and software pCLAMP 10 (Molecular Devices, LLC, Sunnyvale, CA). 2.6 Panel of odorants Oocytes expressing test ORs were challenged with a panel of 90 compounds, including known mosquito oviposition attractants, plant and vertebrate host kairomones, and natural repellents: 1-hexanol, 1-octanol, (E)-2-hexen-1-ol, (Z)-2-hexen-1-ol, 1-hexen-3-ol, 1heptene-3-ol, 3-octanol, 1-octen-3-ol (Kline et al., 1990), 3-oc.