Same type of cancer [49,53,56]. This study identified two overexpressed genes, ANXA
Same type of cancer . This study identified two overexpressed genes, ANXA1 and p16,...
Onstructs by the age of 9. In this study, the predictive impact
Onstructs by the age of 9. In this study, the predictive effect of victim...
Um for 1 h, and fixed with 4 paraformaldehyde at room temperature for
Um for 1 h, and fixed with 4 paraformaldehyde at room temperature for 20...
N or other cyclooxygenase inhibitors were added during platelet preparation. Unless
N or other cyclooxygenase inhibitors were added during platelet preparation. Unless otherwise indicated, 1...
Athways, many not having to do with the atrophy under study.
Athways, many not having to do with the 842-07-9 site atrophy under study.binding of...
Bactin primers (GTGGGGCGCCCCAGGCACCCA, CTCCTT AATGTCACGCACGATTTC) as a housekeeping gene. RNA of
Bactin primers (GTGGGGCGCCCCAGGCACCCA, CTCCTT AATGTCACGCACGATTTC) as a housekeeping gene. RNA of the same sample...
D TTR V30M remained in the supernatant fraction (Fig. 1A
D TTR V30M remained in the supernatant fraction (Fig. 1A). Saturation binding measurements showed...
Specific time points could help direct the choice of therapy and
Specific time points could help direct the choice of therapy and ascertain whether a...
At 37uC in 95 air at 5 carbon dioxide. RAW264.7 stable clones expressing
At 37uC in 95 air at 5 carbon dioxide. RAW264.7 stable clones expressing Teriparatide...
Ace of cellular microtubules such as severing [14] and the binding and
Ace of cellular microtubules such as severing and the binding and motility of...