ells were plated in collagen-coated 24 well plates at 100,000 cells/well. Cells were incubated in serum-free basal adipogenesis medium as described. Adipogenesis was induced by the addition of 23094-71-5 dopamine Receptors in Human Adipocytes Gene B2M ARSA ARSB ARSC DRD1 DRD2 DRD3 DRD4 DRD5 PRL PRLR Genbank Accession Number NM_004048 NM_000487 NM_000046 NM_000351 NM_000794 NM_000795 NM_033660 NM_000797 NM_000798 NM_000948 NM_000949 Forward primer GGCATTCCTGAAGCTGAC TATGCCTCTCACCACAC GCTACCAGATCCGTACAG AGCACTGATAGGGAAATGG CTCCGTTTCCAAATACATTCCA AGCATCGACAGGTACACAG GTGGTATACCTGGAGGTGAC CCGCTCTTCGTCTACTC CTCATCTCCTACAACCAAGAC TTCAGCGAATTCGATAAACGG CGTGACTTACATAGTTCAGCCA Reverse Primer GAATCTTTGGAGTACGCTGG GGTCTCAGGTCCATTGTC TTCCGGTACATTCCCAG AGCAAGGGTAAGGAGGG CACTGTTGATTCTTTGCCCT 
CTCGTTCTGGTCTGCGT GCAGTGTACCTGTCTATGCT ACAGGTTGAAGATGGAGG TGATAGATCTGGAACATGCGA TGATACAGAGGCTCATTCCAG GGAGCGTGAACCAACCA Amplimer Size 114 191 153 216 169 159 136 114 148 181 139 All primer sets were intron-spanning except those for D1 and D5 dopamine receptors. B2M-b2 microglobulin, ARSA-arylsulfatase A, ARSB-arylsulfatase B, ARSCarylsulfatase C, DRD1-D1 dopamine receptor, DRD2-D2 dopamine receptor, DRD3-D3 dopamine receptor, DRD4-D4 dopamine receptor, DRD5-D5 dopamine receptor, PRL-prolactin, PRLR-prolactin receptor. doi:10.1371/journal.pone.0025537.t001 3 September 2011 | Volume 6 | Issue 9 | e25537 Dopamine Receptors in Human Adipocytes Western blot analysis Cells were homogenized in lysis buffer and 35 mg of lysate proteins were separated on 12% SDS gels and transferred to nitrocellulose membranes. For DAR, validated antibodies against D1R, D2R, and D4R were used. For signaling pathways, ERK1/2 phospho ERK 1/2, Phospho Akt and Akt, all from Cell signaling were used at 1:1000. After incubation with horseradish peroxidase-conjugated secondary antibodies, products were exposed to SuperSignal chemiluminescence reagents and photographed; b-actin was used as a loading control. sensitivity for cGMP analysis, samples were first acetylated according to manufacturer’s instructions. Adipokine determination Fluorescent sandwich ELISAs for human leptin, adiponectin and IL-6 were optimized in our lab as described. Briefly, matched monoclonal ab pairs against leptin, adiponectin and IL-6 were used. Plates coated with the capture ab were co-incubated with biotinylated detection ab, antigen standards and CM from explants or cells. Streptavidin-conjugated horseradish peroxidase was added, followed by a fluorimetric substrate. Plates were read at 325 nm excitation and 420 nm emission. Arylsulfatase A Activity ARSA activity was determined by the method of Chang et al after modifications. Briefly, samples were homogenized in 0.05 M acetate buffer, pH 5.0, freeze-thawed, and centrifuged at 12,0006 g for 5 min. Lysates or CM were incubated at 37C in 0.05 M acetate buffer, pH 5.6 containing 3 mM lead acetate, and 5 mM 4-methylumbelliferyl sulfate, with or without 3 mM Ag+. After 30 min, the reaction was stopped with “ 23977191 0.2 M glycine-carbonate buffer, pH 10.4 and 1 mM EDTA. Fluorescence was measured at 370 nm excitation and 450 nm emission, using Gemini fluorescent microplate reader. Enzyme activity was calculated from a standard curve. Data Analysis “ 25331948 Experiments were repeated at least 3 times. Values were expressed as means6SEM. Data were analyzed by Student’s t test or ANOVA. P,0.05 was considered significant. Results Expression of DAR in adipose tissue and adipocytes Conventional RT-PCR was used
Potassium channel potassiun-channel.com
Just another WordPress site
